AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i299_mjan_pyro_100.orf -o299_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00249 136 Pyrococcus_OT3 Motif number 1 CGATCTAGGCTAGTATTCAATCATTTAAAA 1 22 1 TAGTATTCAA 0.979021 -115 CATATGAAAATAATTTTAAATGATTGAATA 1 35 0 TAATTTTAAA 0.98491 -102 TCATATGTTTTAGTTTTCAACCAAGAGTGT 1 58 1 TAGTTTTCAA 0.993691 -79 TGTGAGGGCAAAATTGTCCAGAAAATTTTA 1 85 1 AAATTGTCCA 0.954187 -52 ATTGTCCAGAAAATTTTAAATTCCCTTCAC 1 97 1 AAATTTTAAA 0.978518 -40 ********** Masking position 4 Map Score: 6.04166 Number of sites scoring better than the average of aligned sites = 447 Number in coding regions = 372 Number in noncoding regions = 75 Number of orfs with sites within 600 bp upstream = 80 Fraction of orfs with sites within 600 bp upstream = 0.0128493 Motif number 2 TCATTTAAAATTATTTTCATATGTTTTAGTT 1 42 1 TTTTTTCATA 0.945409 -95 CTGGACAATTTTGCCCTCACACTCTTGGTTG 1 75 0 TTCCCTCACA 0.995971 -62 GAATTTAAAATTTTCTGGACAATTTTGCCCT 1 89 0 TTTCTGGACA 0.977797 -48 AAATTTTAAATTCCCTTCACATGACATCCTT 1 107 1 TTCCTTCACA 0.997627 -30 ** ******** Masking position 9 Map Score: 1.70428 Number of sites scoring better than the average of aligned sites = 120 Number in coding regions = 108 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 TTTTAGTTTTCAACCAAGAGTGTGAGGGCA 1 65 1 CAACCAAGAG 0.997463 -72 AGCTACCAAAAGGATGTCATGT 1 125 0 CTACCAAAAG 0.995272 -12 ********** Masking position 6 Map Score: 0.802485 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 2 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0