AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i325_mjan_pyro_100.orf -o325_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ08781 131 M_jannaschii_chromosome #2 RMJ06449 72 M_jannaschii_chromosome #3 RPH00818 60 Pyrococcus_OT3 Motif number 1 CCTTAAAACTTAGGTATTAAAAAATTAGAAAAAT 1 11 0 TAGTTAAAAA 0.980355 -121 AGATTGGATGAAAACCTTAAAACTTAGGTATTAA 1 25 0 AAATTAAAAT 0.984001 -107 TTTCTTGTAAAACATTTTGAAAGAAACTTTTAGG 1 61 0 AAATTGAAAA 0.989598 -71 TAAAATAGAAAAAAAGTTGAAATATAGTTTCTTG 1 88 0 AAATTGAAAA 0.989598 -44 CTCACCTAATTAAACATTAAAATAGAAAAAAAGT 1 105 0 TAATTAAAAA 0.9903 -27 ATAATCACCATACATCTTATAATAATAGTTAAAA 2 11 1 TAATTATAAA 0.969933 -62 TAATAGTTAAAATATTTTATAAAAAGTATTTTAA 2 33 1 AAATTATAAA 0.983999 -40 GTTATCACCAAAGACATTAAAATACTTTTTATAA 2 49 0 AAATTAAAAA 0.994888 -24 TCCCGAGGTAAAGGTATTAAAAATAGTAACGTTA 3 30 0 AAGTTAAAAT 0.967807 -31 ** * ****** * Masking position 7 Map Score: 19.272 Number of sites scoring better than the average of aligned sites = 694 Number in coding regions = 558 Number in noncoding regions = 136 Number of orfs with sites within 600 bp upstream = 132 Fraction of orfs with sites within 600 bp upstream = 0.0212014 Motif number 2 TAGGTATTAAAAAATTAGAAAAAT 1 5 0 AAAATTAGAA 0.870521 -127 AAAAAAGTTGAAATATAGTTTCTTGTAAAA 1 83 0 AAATATAGTT 0.841727 -49 AATTAAACATTAAAATAGAAAAAAAGTTGA 1 102 0 TAAAATAGAA 0.961193 -30 TACATCTTATAATAATAGTTAAAATATTTT 2 21 1 AATAATAGTT 0.951206 -52 ATACTTTTTATAAAATATTTTAACTATTAT 2 32 0 TAAAATATTT 0.843106 -41 CCAAAGACATTAAAATACTTTTTATAAAAT 2 46 0 TAAAATACTT 0.940001 -27 TAAAGGTATTAAAAATAGTAACGTTAAAGT 3 26 0 AAAAATAGTA 0.981879 -35 ********** Masking position 7 Map Score: 7.22572 Number of sites scoring better than the average of aligned sites = 595 Number in coding regions = 428 Number in noncoding regions = 167 Number of orfs with sites within 600 bp upstream = 156 Fraction of orfs with sites within 600 bp upstream = 0.0250562 Motif number 3 TCTAATTTTTTAATACCTAAGTTTTAAGGT 1 16 1 TAATACCTAA 0.859877 -116 TTTCATCCAATCTTTCCTAAAAGTTTCTTT 1 46 1 TCTTTCCTAA 0.963713 -86 CCTAAAAGTTTCTTTCAAAATGTTTTACAA 1 61 1 TCTTTCAAAA 0.817673 -71 AATCTCACCTAATTAAACATTA 1 120 0 TCTCACCTAA 0.992131 -12 ATAATCACCATACATCTTATAA 2 3 1 AATCACCATA 0.802819 -70 GTTATCACCAAAGACATTAAAA 2 61 0 TATCACCAAA 0.987573 -12 GCTCTCACCACGAAAACTTTAA 3 3 1 TCTCACCACG 0.948645 -58 ********** Masking position 6 Map Score: 4.88776 Number of sites scoring better than the average of aligned sites = 784 Number in coding regions = 626 Number in noncoding regions = 158 Number of orfs with sites within 600 bp upstream = 183 Fraction of orfs with sites within 600 bp upstream = 0.0293929 Motif number 4 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.39152e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0