AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i329_mjan_pyro_300.orf -o329_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00798 50 Pyrococcus_OT3 #2 RPH00797 116 Pyrococcus_OT3 Motif number 1 CTGGAGAAATTATCCAATGAAGGAAGTTAA 1 22 0 TATCCAATGA 0.996876 -29 TTGGATAATTTCTCCAGTGATGAAAA 1 35 1 TCTCCAGTGA 0.992754 -16 CCCACTCCCAGTTCCAATGAATTTGTTAAG 2 20 1 GTTCCAATGA 0.982836 -97 ATGGATATTTTATCCCGTAAGGAACTTAAC 2 44 0 TATCCCGTAA 0.974918 -73 CCTGGGATTCTATTCTATGAAACAATATTT 2 87 0 TATTCTATGA 0.960556 -30 ********** Masking position 3 Map Score: 5.82137 Number of sites scoring better than the average of aligned sites = 94 Number in coding regions = 85 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 CTTTTTAACTTCCTTCATTGGATAATTTCT 1 18 1 TCCTTCATTG 0.943306 -33 TTTTCATCACTGGAGAAATTATC 1 38 0 TCATCACTGG 0.993015 -13 TTTGTTAAGTTCCTTACGGGATAAAATATC 2 41 1 TCCTTACGGG 0.98768 -76 GGATAAAATATCCATACTAGCAACTCTTAA 2 59 1 TCCATACTAG 0.96957 -58 TTTTCTCACCCCTGGGATTCTATTC 2 102 0 TCACCCCTGG 0.989796 -15 ********** Masking position 1 Map Score: 3.84955 Number of sites scoring better than the average of aligned sites = 103 Number in coding regions = 98 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 TTTTTAACTTCCTTCATTGGATAATTTCTC 1 19 1 CCTTCATTGG 0.995681 -32 TTTTCATCACTGGAGAAATTATC 1 38 0 TCATCACTGG 0.989544 -13 GAACTTAACAAATTCATTGGAACTGGGAGT 2 23 0 AATTCATTGG 0.987404 -94 ********** Masking position 6 Map Score: 1.48185 Number of sites scoring better than the average of aligned sites = 32 Number in coding regions = 30 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0