AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i028_tpal_bbur_100.orf -o028_tpal_bbur_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00065 121 AE000520 Motif number 1 CTATCTTGCTTTGCCGATCCG 1 2 0 TTGCCGATCC 0.989667 -120 CTGCTGCTGTTTGCCTCTCACGGTTCTGAG 1 42 0 TTGCCTCTCA 0.994312 -80 TTCAGATGACTCGCTGCTGCTGTTTGCCTC 1 55 0 TCGCTGCTGC 0.994162 -67 TATGTGAGTGTTGCTTCAGATGACTCGCTG 1 69 0 TTGCTTCAGA 0.958345 -53 GGAAGCGATATTGTCGCCCCCTATGTGAGT 1 90 0 TTGTCGCCCC 0.990162 -32 GGCGACAATATCGCTTCCCTGAGAACGCAA 1 102 1 TCGCTTCCCT 0.982591 -20 ********** Masking position 1 Map Score: 7.44586 Number of sites scoring better than the average of aligned sites = 1999 Number in coding regions = 576 Number in noncoding regions = 1423 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 2 TGCCTCTCACGGTTCTGAGGATCACTTTTC 1 31 0 GGTTCTGAGG 0.998399 -91 CAGATGACTCGCTGCTGCTGTTTGCCTCTC 1 53 0 GCTGCTGCTG 0.992932 -69 TGTGAGTGTTGCTTCAGATGACTCGCTGCT 1 67 0 GCTTCAGATG 0.993836 -55 TTGCGTTCTCAGGGAAGCGATAT 1 109 0 CGTTCTCAGG 0.98578 -13 ********** Masking position 3 Map Score: 3.99548 Number of sites scoring better than the average of aligned sites = 218 Number in coding regions = 54 Number in noncoding regions = 164 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 CGGATCGGCAAAGCAAGATA 1 1 1 CGGATCGGCA 0.99381 -121 AGATAGAAAAGTGATCCTCAGAACCGTGAG 1 26 1 GTGATCCTCA 0.963169 -96 CCTCAGAACCGTGAGAGGCAAACAGCAGCA 1 41 1 GTGAGAGGCA 0.990864 -81 CACTCACATAGGGGGCGACAATATCGCTTC 1 89 1 GGGGGCGACA 0.997044 -33 GCGTTCTCAGGGAAGCGATATTGTCGCCCC 1 100 0 GGAAGCGATA 0.968015 -22 ********** Masking position 10 Map Score: 4.05536 Number of sites scoring better than the average of aligned sites = 1364 Number in coding regions = 442 Number in noncoding regions = 922 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 4 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.46782e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0