AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i054_tpal_bbur_100.orf -o054_tpal_bbur_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00743 178 3615 #2 RBB00715 64 3615 Motif number 1 GATTAGTATTTTAGCATAATTTT 1 4 1 TAGTATTTTA 0.952058 -175 TATTTTAGCATAATTTTTTGTTTATGTTTT 1 17 1 TAATTTTTTG 0.864444 -162 TTTTTTGTTTATGTTTTTGATTTGAAGTTT 1 30 1 ATGTTTTTGA 0.960323 -149 TTTTGATTTGAAGTTTTTTAGAACTTTTAT 1 44 1 AAGTTTTTTA 0.991391 -135 TTTATTTTTTCAATTTTTTATATTTATATT 1 69 1 CAATTTTTTA 0.970602 -110 TATTTATATTATATTTTTAATATTATTAAA 1 89 1 ATATTTTTAA 0.946259 -90 AAAACATCAACTATTTTTAATAATATTAAA 1 104 0 CTATTTTTAA 0.922158 -75 AAAATAGTTGATGTTTTTTAATATAAACTA 1 117 1 ATGTTTTTTA 0.987446 -62 ATATAAACTATAGTATTTTAATATATGACA 1 137 1 TAGTATTTTA 0.952058 -42 CTTTACAATCAAGTTTTTAAAAACTCATTT 2 37 0 AAGTTTTTAA 0.983716 -28 ********** Masking position 6 Map Score: 18.2755 Number of sites scoring better than the average of aligned sites = 497 Number in coding regions = 138 Number in noncoding regions = 359 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 2 GATTAGTATTTTAGCATAATTTTTTGTTT 1 10 1 TTTAGCATAA 0.983623 -169 ATATTAAAAATATAATATAAATATAAAAAA 1 82 0 TATAATATAA 0.908272 -97 ATATTATATTTTTAATATTATTAAAAATAG 1 94 1 TTTAATATTA 0.935479 -85 GTTGATGTTTTTTAATATAAACTATAGTAT 1 123 1 TTTAATATAA 0.978017 -56 ACTATAGTATTTTAATATATGACAATTTTC 1 143 1 TTTAATATAT 0.954187 -36 TATTTAAGCATGTTTAAGCATGA 2 4 1 TTAAGCATGT 0.916355 -61 TTAAGCATGTTTAAGCATGAGTTAAATGAG 2 14 1 TTAAGCATGA 0.959287 -51 ********** Masking position 4 Map Score: 8.33763 Number of sites scoring better than the average of aligned sites = 85 Number in coding regions = 29 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 GCATAATTTTTTGTTTATGTTTTTGATTTG 1 24 1 TTGTTTATGT 0.986018 -155 ATTTTTTCAATTTTTTATATTTATATTATA 1 72 1 TTTTTTATAT 0.966657 -107 TTTTTATATTTATATTATATTTTTAATATT 1 83 1 TATATTATAT 0.92662 -96 TTATTAAAAATAGTTGATGTTTTTTAATAT 1 111 1 TAGTTGATGT 0.978505 -68 TAAAATACTATAGTTTATATTAAAAAACAT 1 127 0 TAGTTTATAT 0.98943 -52 ********** Masking position 5 Map Score: 5.68163 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 6 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0