AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i055_tpal_bbur_300.orf -o055_tpal_bbur_300.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00743 178 3615 #2 RBB00715 64 3615 #3 RBB00576 27 3615 Motif number 1 AAAAATTATGCTAAAATACTAATC 1 5 0 CTAAAATACT 0.935155 -174 AAAAACATAAACAAAAAATTATGCTAAAAT 1 18 0 ACAAAAAATT 0.910417 -161 AAAACTTCAAATCAAAAACATAAACAAAAA 1 31 0 ATCAAAAACA 0.958232 -148 AATAAAAGTTCTAAAAAACTTCAAATCAAA 1 45 0 CTAAAAAACT 0.983086 -134 TAATATAAATATAAAAAATTGAAAAAATAA 1 70 0 ATAAAAAATT 0.981807 -109 TTTTAATAATATTAAAAATATAATATAAAT 1 90 0 ATTAAAAATA 0.953625 -89 TTTTAATATTATTAAAAATAGTTGATGTTT 1 103 1 ATTAAAAATA 0.953625 -76 ATAGTTTATATTAAAAAACATCAACTATTT 1 118 0 TTAAAAAACA 0.978406 -61 TTGTCATATATTAAAATACTATAGTTTATA 1 138 0 TTAAAATACT 0.930359 -41 CAATCAAGTTTTTAAAAACTCATTTAACTC 2 32 0 TTTAAAAACT 0.960599 -33 TTAATTTCACATAAAAAATACTG 3 4 0 ATAAAAAATA 0.978455 -24 ********** Masking position 5 Map Score: 22.1753 Number of sites scoring better than the average of aligned sites = 466 Number in coding regions = 133 Number in noncoding regions = 333 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 ATAAACAAAAAATTATGCTAAAATACTAAT 1 12 0 AATTATGCTA 0.720811 -167 ATAATTTTTTGTTTATGTTTTTGATTTGAA 1 26 1 GTTTATGTTT 0.982056 -153 ATGTTTTTGATTTGAAGTTTTTTAGAACTT 1 40 1 TTTGAAGTTT 0.903999 -139 TTTTTAGAACTTTTATTTTTTCAATTTTTT 1 58 1 TTTTATTTTT 0.806515 -121 TTTTTCAATTTTTTATATTTATATTATATT 1 74 1 TTTTATATTT 0.931799 -105 TTTATATTTATATTATATTTTTAATATTAT 1 85 1 TATTATATTT 0.862932 -94 ATTAAAAATAGTTGATGTTTTTTAATATAA 1 113 1 GTTGATGTTT 0.949931 -66 AAATACTATAGTTTATATTAAAAAACATCA 1 125 0 GTTTATATTA 0.850021 -54 TATTTAAGCATGTTTAAGCAT 2 2 1 ATTTAAGCAT 0.713826 -63 ATTTAAGCATGTTTAAGCATGAGTTAAATG 2 12 1 GTTTAAGCAT 0.798247 -53 CAACCTTTACAATCAAGTTTTTAAAAACTC 2 41 0 AATCAAGTTT 0.657815 -24 CAGTATTTTTTATGTGAAATTAAATTT 3 8 1 TTTTATGTGA 0.719948 -20 TTTTATGTGAAATTAAATTT 3 18 1 AATTAAATTT 0.766999 -10 ********** Masking position 5 Map Score: 10.2347 Number of sites scoring better than the average of aligned sites = 1494 Number in coding regions = 427 Number in noncoding regions = 1067 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 3 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0