AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i113_tpal_bbur_100.orf -o113_tpal_bbur_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00139 102 AE000520 Motif number 1 TCTGCCGCTAACAGCAAGTGAGTACGGGCG 1 12 0 ACAGCAAGTG 0.98967 -91 TATCCCCTCCATCGAAAGCGGCATCTGCCG 1 35 0 ATCGAAAGCG 0.994451 -68 GATGGAGGGGATAGAGCGCGTGCACGTGCT 1 52 1 ATAGAGCGCG 0.994083 -51 CGCGTACCAAAAAGCACGTGCACGCGCTCT 1 64 0 AAAGCACGTG 0.992579 -39 GAAAACGGTCAACGTACGCGTACCAAAAAG 1 80 0 AACGTACGCG 0.968191 -23 ********** Masking position 1 Map Score: 8.31746 Number of sites scoring better than the average of aligned sites = 24 Number in coding regions = 5 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 AACAGCAAGTGAGTACGGGCGT 1 3 0 GAGTACGGGC 0.988793 -100 CTCACTTGCTGTTAGCGGCAGATGCCGCTT 1 20 1 GTTAGCGGCA 0.977749 -83 CCCCTCCATCGAAAGCGGCATCTGCCGCTA 1 32 0 GAAAGCGGCA 0.994692 -71 GGAGGGGATAGAGCGCGTGCACGTGCTTTT 1 55 1 GAGCGCGTGC 0.690754 -48 GTGCTTTTTGGTACGCGTACGTTGACCGTT 1 77 1 GTACGCGTAC 0.499754 -26 CAGGAAAACGGTCAACGTACGCG 1 90 0 GAAAACGGTC 0.979985 -13 ********** Masking position 6 Map Score: 8.06053 Number of sites scoring better than the average of aligned sites = 892 Number in coding regions = 244 Number in noncoding regions = 648 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 TGCCGCTAACAGCAAGTGAGTACGGGCGT 1 10 0 AGCAAGTGAG 0.90842 -93 CGTACCAAAAAGCACGTGCACGCGCTCTAT 1 62 0 AGCACGTGCA 0.516253 -41 ********** Masking position 4 Map Score: 0.0362425 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 1 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0