AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i174_tpal_bbur_300.orf -o174_tpal_bbur_300.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00382 170 AE000520 #2 RTP00949 206 AE000520 Motif number 1 GGAGCGCGAGCGCAGCCACGTCGAGCACATTA 1 34 0 CGCGCACGTC 0.997312 -137 TTTAAGATCACGGTGGTGGAGCGCGAGCGCAG 1 51 0 CGGGTGGAGC 0.983949 -120 AAGAAGAACACCGGGACACGGCGGAGAAAACG 1 89 0 CCGGCACGGC 0.991505 -82 ATTTTGAAAACGGATACACGTCAAATTACCTG 1 125 0 CGGTCACGTC 0.97097 -46 GCTTTCAGGCGCTGGCGGATGCGTATTTTGA 1 150 0 CGCGCGGATG 0.989157 -21 TGGGCGTCGACGCCGACACGTCTTGATTCACT 2 69 0 CGCGCACGTC 0.997307 -138 CTGTTCCGGCCGGAGCTGGGGCTAGAGTTTGC 2 123 0 CGGGTGGGGC 0.991766 -84 ACAGCAAACTCCCTGCCGCAGGCTTTTTAATC 2 151 1 CCCGCGCAGG 0.977929 -56 AATTATTTGGCGCAAGCGGATCATACTGAG 2 187 1 CGCACGGATC 0.97097 -20 *** * ****** Masking position 1 Map Score: 14.7309 Number of sites scoring better than the average of aligned sites = 1133 Number in coding regions = 359 Number in noncoding regions = 774 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 2 TAATGTGCTCGACGTGGCTGCGCTCGCGCT 1 34 1 GACGTGGCTG 0.989199 -137 TAAGATCACGGTGGTGGAGCGCGAGCGCAG 1 51 0 GTGGTGGAGC 0.985984 -120 CGTTTTCTCCGCCGTGTCCCGGTGTTCTTC 1 89 1 GCCGTGTCCC 0.982479 -82 CAGGTAATTTGACGTGTATCCGTTTTCAAA 1 125 1 GACGTGTATC 0.935646 -46 GCTTTCAGGCGCTGGCGGATGCGTATTT 1 153 0 GCGCTGGCGG 0.988672 -18 CAATGCGGGTGTCGTGGAGTTTTGCGTATT 2 22 0 GTCGTGGAGT 0.943509 -185 AGTGAATCAAGACGTGTCGGCGTCGACGCC 2 69 1 GACGTGTCGG 0.990997 -138 TTTTTTCGTTGCGGTGGGCGTCGACGCCGA 2 85 0 GCGGTGGGCG 0.986339 -122 GTTCCGGCCGGAGCTGGGGCTAGAGTTTGC 2 123 0 GAGCTGGGGC 0.955701 -84 ********** Masking position 5 Map Score: 13.0155 Number of sites scoring better than the average of aligned sites = 2148 Number in coding regions = 617 Number in noncoding regions = 1531 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 3 CATTAAGGGAACGAAGAATACA 1 2 0 ACGAGAATAC 0.979217 -169 CCGGGACACGGCGGAGAAAACGCTTTCGTTT 1 80 0 GCGAGAAAAC 0.99502 -91 TACCTGAACAAAGAAGAACACCGGGACACGG 1 100 0 AAGAGAACAC 0.930466 -71 GAAAAAAAGGGCGTTGCAAACTCTAGCCCCA 2 108 1 GCGTGCAAAC 0.987242 -99 GCTCCGGCCGGAACAGCAAACTCCCTGCCGC 2 139 1 GAAAGCAAAC 0.942605 -68 TTTGGCGCAAGCGGATCATACTGAG 2 192 1 GCGATCATAC 0.971362 -15 *** ******* Masking position 8 Map Score: 4.36624 Number of sites scoring better than the average of aligned sites = 248 Number in coding regions = 72 Number in noncoding regions = 176 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 TGTATTCTTCGTTCCCTTAATGATAA 1 6 1 TCTTGTTCCC 0.991678 -165 AACGCTTTCGTTTAAGATCACGGTGGTGGAG 1 62 0 TTTAGATCAC 0.816644 -109 CCGGTGTTCTTCTTTGTTCAGGTAATTTGAC 1 107 1 TCTTGTTCAG 0.977741 -64 TGTCTCTGATACTTCAATGCGGGTGTCGTGG 2 35 0 ACTTAATGCG 0.747168 -172 CGCCGACACGTCTTGATTCACTGTTTGTCTC 2 60 0 TCTTATTCAC 0.96544 -147 AACGCCCTTTTTTTCGTTGCGGTGGGCGTCG 2 92 0 TTTTGTTGCG 0.94881 -115 TGCCGCAGGCTTTTTAATCCCCAAATTATTT 2 164 1 TTTTAATCCC 0.955463 -43 **** ****** Masking position 8 Map Score: 2.17003 Number of sites scoring better than the average of aligned sites = 811 Number in coding regions = 234 Number in noncoding regions = 577 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 5 CGTGGCTGCGCTCGCGCTCCACCACCGTGA 1 46 1 CTCGCGCTCC 0.993422 -125 CCTTGAGCCTCAATACGCAAA 2 2 1 CTTGAGCCTC 0.989601 -205 GCGTTGCAAACTCTAGCCCCAGCTCCGGCC 2 118 1 CTCTAGCCCC 0.990211 -89 GTATGATCCGCTTGCGCCAAATAATTTGGG 2 183 0 CTTGCGCCAA 0.970666 -24 ********** Masking position 2 Map Score: 1.59942 Number of sites scoring better than the average of aligned sites = 121 Number in coding regions = 30 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 ********** No masking Map Score: 8.26662e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 8.26662e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 8.26662e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0