AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i203_tpal_bbur_100.orf -o203_tpal_bbur_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00159 29 AE000520 #2 RTP00160 86 AE000520 #3 RTP00161 89 AE000520 Motif number 1 ACGAAGCCTTTTCCTTTGCAA 2 1 0 TTCCTTTGCA 0.980527 -86 TCCCCGTCAAGCCCTCTTCCATCCAGTAATA 2 31 0 GCCCTCTTCA 0.9904 -56 CTGATAATAATTCCCCGTCAAGCCCTCTTCC 2 42 0 TTCCCCGTCA 0.993836 -45 TGGATAACAAGTTCATGTCCATGCTGACCC 3 10 0 GTTCATGTCA 0.906346 -80 TGTTATCCACGTACACTGCGAATTTCCCCGA 3 32 1 GTACACTGCA 0.931988 -58 CACTGCGAATTTCCCCGACGAAATGTAGAAA 3 45 1 TTCCCCGACA 0.980402 -45 AGAATCCAGTTCCCTTTTCTACATTTCGTCG 3 60 0 TCCCTTTTCA 0.976394 -30 ********* * Masking position 11 Map Score: 5.72904 Number of sites scoring better than the average of aligned sites = 2113 Number in coding regions = 659 Number in noncoding regions = 1454 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 AGAGGCTGCTGCAAACTATTCGTCTCA 1 7 0 GCAAACTTTC 0.764955 -23 ATAGTTTGCAGCAGCCTCTTT 1 19 1 GCAGCCTTTT 0.985604 -11 CCAGTAATACGAAGCCTTTTCCTTTGCAA 2 9 0 GAAGCCTTTC 0.886211 -78 TTTTGGGGTTGAAACCACTGATAATAATTCC 2 59 0 GAAACCATGA 0.943174 -28 CCAGAACGAAGAATCCAGTTCCCTTTTCTAC 3 69 0 GAATCCATTC 0.984075 -21 ******* *** Masking position 3 Map Score: 2.95937 Number of sites scoring better than the average of aligned sites = 400 Number in coding regions = 129 Number in noncoding regions = 271 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 ACTGATAATAATTCCCCGTCAAGCCCTCTT 2 44 0 ATTCCCCGTC 0.996838 -43 ATGAACTTGTTATCCACGTACACTGCGAAT 3 25 1 TATCCACGTA 0.976936 -65 ACACTGCGAATTTCCCCGACGAAATGTAGA 3 44 1 TTTCCCCGAC 0.996837 -46 ********** Masking position 3 Map Score: 1.57154 Number of sites scoring better than the average of aligned sites = 266 Number in coding regions = 82 Number in noncoding regions = 184 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 4 TTGCAAAGGAAAAGGCTTCGTATTAC 2 7 1 AGGAAAAGGC 0.990967 -80 ATTACTGGATGGAAGAGGGCTTGACGGGGA 2 32 1 GGAAGAGGGC 0.996039 -55 GACGAAATGTAGAAAAGGGAACTGGATTCT 3 61 1 AGAAAAGGGA 0.992397 -29 ********** Masking position 6 Map Score: 0.741859 Number of sites scoring better than the average of aligned sites = 107 Number in coding regions = 33 Number in noncoding regions = 74 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.60993e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0