AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i233_tpal_bbur_300.orf -o233_tpal_bbur_300.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RTP00651 75 AE000520 #2 RTP00654 39 AE000520 #3 RTP00655 46 AE000520 Motif number 1 CCCGTAAAACTGTGCGGTGCGCGGT 1 5 0 TGTCGGTGCG 0.952072 -71 TACCGCATGTTCTCCCGTAAAACTGTGCGGT 1 18 0 TCTCCGTAAA 0.898718 -58 ACAAATAATTTCTACCGCATGTTCTCCCGTA 1 30 0 TCTCCGCATG 0.963607 -46 CCTGTACGGTACGCACGCCCCCA 1 63 0 TGTCGGTACG 0.609954 -13 TATTTTTTCCTCTCCGGCACAGGATTTGA 2 21 1 TCTCGGCACA 0.880361 -19 ACATCTTCAATGAGTTTTTCGATG 3 4 1 TCTCAATGAG 0.956742 -43 TTCAATGAGTTTTTCGATGAGCTTGTAGCCG 3 16 1 TTTCGATGAG 0.956717 -31 *** ******* Masking position 3 Map Score: 8.86601 Number of sites scoring better than the average of aligned sites = 624 Number in coding regions = 191 Number in noncoding regions = 433 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 ACCGCGCACCGCACAGTTTTAC 1 3 1 CGCGCACCGC 0.998164 -73 CTGTACGGTACGCACGCCCCCATGACAAAT 1 55 0 CGCACGCCCC 0.99766 -21 AAGTAGGCCGCGGCTACAAGC 3 36 0 AGTAGGCCGC 0.992787 -11 ********** Masking position 7 Map Score: 1.65079 Number of sites scoring better than the average of aligned sites = 26 Number in coding regions = 6 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 GTTCTCCCGTAAAACTGTGCGGTGCGCGGT 1 11 0 AAAACTGTGC 0.995128 -65 AGGAAAAAATAACCCGGTGCT 2 2 0 AACCCGGTGC 0.997203 -38 TCAAATCCTGTGCCGGAGAGGAA 2 27 0 AATCCTGTGC 0.998145 -13 ********** Masking position 2 Map Score: 4.66098 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 18 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ACATCTTCAATGAGTTTTTCGATGAG 3 7 1 TCAATGAGTT 0.993881 -40 AATGAGTTTTTCGATGAGCTTGTAGCCGCG 3 19 1 TCGATGAGCT 0.997205 -28 ********** Masking position 5 Map Score: 0.310387 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 0 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0