AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i308_tpal_bbur_300.orf -o308_tpal_bbur_300.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/synecho.fna -g0.40 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.4 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RBB00532 26 3615 Input sequences: #1 RBB00533 52 3615 #2 RBB00883 74 3615 #3 RBB00339 77 3615 #4 RBB00328 18 3615 #5 RBB00301 35 3615 Motif number 1 TGAATATATAAAATTAAATTTTTGCTATAA 1 11 1 AAATTAAATT 0.93621 -42 ATAATATATATTATATAATA 2 1 1 ATAATATATA 0.977912 -74 AATATAATGTATATTATATAATATATATTA 2 12 0 ATATTATATA 0.973015 -63 TATATAATATACATTATATTTGAATTTATA 2 22 1 ACATTATATT 0.916663 -53 AAAGGACATCAAAATTTATAAATTCAAATA 2 38 0 AAAATTTATA 0.918703 -37 AGAAAATCTAAAAATAAAAAAATATCAATA 3 33 0 AAAATAAAAA 0.901126 -45 TTTTCTTAAAAAAAGAAATAGAGGTAGGTT 3 57 1 AAAAGAAATA 0.966017 -21 AGCAAGTAAAAGATATTT 4 8 1 AAAAGATATT 0.946966 -11 TAAACCAAACATATTAAATAAGT 5 4 0 ATATTAAATA 0.967031 -32 ********** Masking position 3 Map Score: 12.2664 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 100 Number in noncoding regions = 211 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 GATTATAGCAAAAATTTAATTTTATATATTCA 1 9 0 AAATTTTTTA 0.901867 -44 AATTTTTGCTATAATCTTATTTTAAGAGAGAAAA 1 27 1 ATATTTTTTA 0.98096 -26 TAATATACATTATATTTGAATTTATAAATTTTGA 2 26 1 TAATTATTTA 0.868789 -49 TTTATAAATTTTGATGTCCTTTTGTTAAGGTTGT 2 46 1 TTATTTTTTG 0.977707 -29 TGTCCTTTTGTTAAGGTTGTTTTAA 2 60 1 TTAGTTTTTA 0.987406 -15 ATATCAATAATGTATCAAGTTTTACTAATTA 3 8 0 TGATATTTTA 0.889084 -70 TGATACATTATTGATATTTTTTTATTTTTAGATT 3 25 1 TTATTTTTTA 0.99465 -53 TTTTTTTATTTTTAGATTTTCTTAAAAAAAGAAA 3 41 1 TTAGTTCTTA 0.943922 -37 AAACCTACCTCTATTTCTTTTTTTAAGAAAATC 3 55 0 TCATTTTTTT 0.901029 -23 TTAATCTCCTTATAAACCAAACAT 5 22 0 TTATTTTATA 0.963173 -14 ** ** * ***** Masking position 4 Map Score: 12.2803 Number of sites scoring better than the average of aligned sites = 365 Number in coding regions = 100 Number in noncoding regions = 265 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 AAATTTAATTTTATATATTCA 1 2 0 TTATATATTC 0.91929 -51 TTTTCTCTCTTAAAATAAGATTATAGCAAA 1 31 0 TAAAATAAGA 0.914632 -22 ATAATGTATATTATATAATATATATTAT 2 9 0 TTATATAATA 0.938564 -66 ACATCAAAATTTATAAATTCAAATATAATG 2 33 0 TTATAAATTC 0.916296 -42 AATCTAAAAATAAAAAAATATCAATAATGT 3 29 0 TAAAAAAATA 0.924873 -49 TTTCTTTTTTTAAGAAAATCTAAAAATAAA 3 45 0 TAAGAAAATC 0.91957 -33 ACCAAACATATTAAATAAGT 5 1 0 TTAAATAAGT 0.848453 -35 ********** Masking position 5 Map Score: 3.19304 Number of sites scoring better than the average of aligned sites = 450 Number in coding regions = 139 Number in noncoding regions = 311 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.72438e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0