AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -ihipB_bbur_opreg_100.orf -g0.282 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.282 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 BB0434 118 stage 0 sporulation protein J (spo0J) Motif number 1 AGAATTGGTTTTTCTTGTTTAAGAAT 1 5 1 TTGTTTTCTT 0.978858 -114 ATGTTCCACGTGGAACATTCTTAAACAAGAAA 1 21 0 TGGAATTCTT 0.997561 -98 ATGTTCCACGTGGAACATTCTTTTTTTTTATT 1 35 1 TGGAATTCTT 0.997561 -84 AACATTCTTTTTTTTTATTCTTAAATTGTAAT 1 48 1 TTTTATTCTT 0.967029 -71 TATTATAACCTGGTAAAATTTTGTGTTGTAGG 1 84 1 TGGAAATTTT 0.966423 -35 *** * ****** Masking position 9 Map Score: 6.25819 Number of sites scoring better than the average of aligned sites = 178 Number in coding regions = 126 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 AAAAAAAGAATGTTCCACGTGGAACATTCT 1 32 0 TGTTCCACGT 0.993666 -87 AACACAAAATTTTACCAGGTTATAATATTG 1 81 0 TTTACCAGGT 0.994694 -38 AATTTTGTGTTGTAGGAGGTTTTGACAAT 1 100 1 TGTAGGAGGT 0.993414 -19 ********** Masking position 7 Map Score: 1.41859 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 5 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.16119e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0