AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_bsub.txt -z/skink1/amcguire/genomes/bsub.fna -ideoR_bsub_opreg_100.orf -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 dra 105 deoxyribose-phosphate aldolase Motif number 1 CAATGAAAGGTTTGAACGTG 1 1 0 TTTGAACGTG 0.983733 -105 CAAACCTTTCATTGAACAAAATTTCAATTA 1 17 1 ATTGAACAAA 0.928965 -89 ATAACCGACTTTTGAACATATGTAAATTGG 1 47 0 TTTGAACATA 0.940277 -59 TTAAGATATTTTTTAGCATAACCGACTTTT 1 64 0 TTTTAGCATA 0.981472 -42 CTAAAAAATATCTTAACAAAAAAGGAAGTG 1 78 1 TCTTAACAAA 0.972669 -28 ********** Masking position 5 Map Score: 7.20448 Number of sites scoring better than the average of aligned sites = 579 Number in coding regions = 468 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 136 Fraction of orfs with sites within 600 bp upstream = 0.0218439 Motif number 2 ATTTTGTTCAATGAAAGGTTTGAACGTG 1 9 0 ATGAAAGGTT 0.981694 -97 AAATTGGTAATTGAAATTTTGTTCAATGAA 1 24 0 TTGAAATTTT 0.970359 -82 ATTACCAATTTACATATGTTCAAAAGTCGG 1 43 1 TACATATGTT 0.632953 -63 CTTTTTTGTTAAGATATTTTTTAGCATAAC 1 72 0 AAGATATTTT 0.839928 -34 CTTAACAAAAAAGGAAGTGTGCGAAGG 1 89 1 AAGGAAGTGT 0.936499 -17 ********** Masking position 6 Map Score: 1.28755 Number of sites scoring better than the average of aligned sites = 1133 Number in coding regions = 915 Number in noncoding regions = 218 Number of orfs with sites within 600 bp upstream = 230 Fraction of orfs with sites within 600 bp upstream = 0.0369419 Motif number 3 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.9652e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0