AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -isoxS_hpyl_opreg_100.orf -g0.389 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.389 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HP1101 65 glucose-6-phosphate dehydrogenase (g6pD) #2 HP1325 174 fumarase (fumC) Motif number 1 ATCTTAATTAAAGGGGTATTC 1 2 0 AAGGGGTATT 0.981321 -64 CCCTTTAATTAAGATTTAATATATAATAAT 1 17 1 AAGATTTAAT 0.780153 -49 TAGAGTGTTTTTGAGTTATTATTATATATT 1 34 0 TTGAGTTATT 0.918433 -32 ATAACCCTTTTAGAGTGTTTTTGAGTTATT 1 44 0 TAGAGTGTTT 0.965917 -22 AACACTCTAAAAGGGTTATTG 1 55 1 AAGGGTTATT 0.995554 -11 TTACACAAAAGAGGGTTATTATCCGTTCGC 2 52 0 GAGGGTTATT 0.987998 -123 AAATTGTGGAAATGGTGTTTAAAAAATTAG 2 82 1 AATGGTGTTT 0.897503 -93 TTTAAAAAATTAGGGTTTTTAAGTAGAAGG 2 99 1 TAGGGTTTTT 0.991298 -76 TAGAAGGTATAAGAGTTTATGCTATTTTTT 2 122 1 AAGAGTTTAT 0.967077 -53 ********** Masking position 10 Map Score: 14.31 Number of sites scoring better than the average of aligned sites = 1767 Number in coding regions = 1525 Number in noncoding regions = 242 Number of orfs with sites within 600 bp upstream = 174 Fraction of orfs with sites within 600 bp upstream = 0.0279473 Motif number 2 AAATCTTAATTAAAGGGGTATTC 1 4 0 TAAAGGGGTA 0.942959 -62 ACCCCTTTAATTAAGATTTAATATATAATA 1 15 1 TTAAGATTTA 0.910889 -51 TTTAGAGTGTTTTTGAGTTATTATTATATA 1 36 0 TTTTGAGTTA 0.850912 -30 AAAACACTCTAAAAGGGTTATTG 1 53 1 AAAAGGGTTA 0.982159 -13 TTTTACACAAAAGAGGGTTATTATCCGTTC 2 54 0 AAGAGGGTTA 0.945416 -121 AAAATTGTGGAAATGGTGTTTAAAAAATTA 2 81 1 AAATGGTGTT 0.823853 -94 TGTTTAAAAAATTAGGGTTTTTAAGTAGAA 2 97 1 ATTAGGGTTT 0.977396 -78 AGTAGAAGGTATAAGAGTTTATGCTATTTT 2 120 1 ATAAGAGTTT 0.972343 -55 TGCTATTTTTTTAAGGTTTTAAAATCAAAT 2 141 1 TTAAGGTTTT 0.959649 -34 ATCCTTTGAAATTTGATTTTAAAACCTTAA 2 151 0 ATTTGATTTT 0.780985 -24 ********** Masking position 9 Map Score: 11.1974 Number of sites scoring better than the average of aligned sites = 2403 Number in coding regions = 2038 Number in noncoding regions = 365 Number of orfs with sites within 600 bp upstream = 227 Fraction of orfs with sites within 600 bp upstream = 0.03646 Motif number 3 TATATATTAAATCTTAATTAAAGGGGTATTC 1 7 0 ATCATAAGGG 0.997975 -59 ATAACTCAAAAACACTCTAAAAGGGTTATTG 1 45 1 AACTTAAGGG 0.988571 -21 TTTTCTTGTTATCTTAATGTAAAGGTCAAAACG 2 9 0 ATCATAAAGG 0.997182 -166 AGGTTTTAAAATCAAATTTCAAAGGATTAGC 2 154 1 ATCATAAAGG 0.997207 -21 *** * * ***** Masking position 8 Map Score: 3.02648 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 22 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 AAGATAACAAGAAAATTCTTGTTGCGAACG 2 29 1 GAAAATTCTT 0.932186 -146 ACACCATTTCCACAATTTTTACACAAAAGA 2 70 0 CACAATTTTT 0.936059 -105 ACTTAAAAACCCTAATTTTTTAAACACCAT 2 93 0 CCTAATTTTT 0.983589 -82 AAGAGTTTATGCTATTTTTTTAAGGTTTTA 2 132 1 GCTATTTTTT 0.964298 -43 GCTAATCCTTTGAAATTTGA 2 165 0 GCTAATCCTT 0.97739 -10 ********** Masking position 6 Map Score: 1.97466 Number of sites scoring better than the average of aligned sites = 411 Number in coding regions = 355 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0