AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_hpyl.txt -z/home/amcguire/genomes/hpyl.fna -itorR_hpyl_opreg_300.orf -g0.389 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.389 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HP0404 80 protein kinase C inhibitor (SP:P16436) #2 HP0406 25 H. pylori predicted coding region HP0406 #3 HP0407 103 biotin sulfoxide reductase (bisC) Motif number 1 ATTATAGCTTTTTAAAAATAAAATATAAGGA 1 17 0 TTTAAAATAA 0.951303 -64 TTTATTAAAGTTGTATTATAGCTTTTTAAAA 1 31 0 TTGTATATAG 0.909974 -50 AAGGTTTTTCTTTTATTAAAGTTGTATTATA 1 42 0 TTTTATAAAG 0.643212 -39 TAAAACTATTTTTAAGGAAAAAT 2 13 1 TTTAAGAAAA 0.919871 -13 TTTTAAATTAACGCCCATGCT 3 1 1 TTTTAATTAA 0.921463 -103 TTAGCGGTAATTTTAGGTGAATCTATGTTAG 3 41 1 TTTTAGTGAA 0.943403 -63 ACACCCCAAATTCTAACATAGATTCACCTAA 3 53 0 TTCTAAATAG 0.914218 -51 ATTTGGGGTGTTTTAACAGAATGCAAGCTTG 3 73 1 TTTTAAAGAA 0.882592 -31 GAATGCAAGCTTGAAGGAGAATC 3 91 1 TTGAAGAGAA 0.948076 -13 ****** **** Masking position 5 Map Score: 8.44234 Number of sites scoring better than the average of aligned sites = 1513 Number in coding regions = 1171 Number in noncoding regions = 342 Number of orfs with sites within 600 bp upstream = 266 Fraction of orfs with sites within 600 bp upstream = 0.0427241 Motif number 2 TAAAGTTGTATTATAGCTTTTTAAAAATAAAA 1 25 0 TTATGCTTTT 0.964325 -56 TTTGCTCCCTTTTAAGGTTTTTCTTTTATTAA 1 54 0 TTTAGGTTTT 0.986652 -27 TGAGGGCTTATTAGCGGTAATTTTAGGTGAAT 3 31 1 TTAGGGTATT 0.987633 -73 TATGTTAGAATTTGGGGTGTTTTAACAGAATG 3 64 1 TTTGGGTTTT 0.995069 -40 **** *** *** Masking position 8 Map Score: 1.05138 Number of sites scoring better than the average of aligned sites = 423 Number in coding regions = 367 Number in noncoding regions = 56 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 3 ATATTTTATTTTTAAAAAGCTATAATACAA 1 22 1 TTTAAAAAGC 0.975514 -59 TTAAAAGGGAGCAAAAAAGC 1 71 1 GCAAAAAAGC 0.981419 -10 TAAAATTACCGCTAATAAGCCCTCAGCATG 3 26 0 GCTAATAAGC 0.621879 -78 ********** Masking position 5 Map Score: 1.85027 Number of sites scoring better than the average of aligned sites = 201 Number in coding regions = 180 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 4 ********** No masking Map Score: -2.32047e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.32047e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.32047e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0