AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -iflhCD_mtub_opreg_300.orf -g0.656 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.656 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv3288c 34 hypothetical protein Rv3288c #2 Rv3289c 33 hypothetical protein Rv3289c #3 lat 50 lat #4 Rv3291c 30 hypothetical protein Rv3291c Motif number 1 GCCGTCGGCCAGGTCGGCCG 1 1 1 GCCGTCGGCC 0.831733 -34 TTATTTGTTGACCGCGGCCGACCTGGCCG 1 16 0 GACCGCGGCC 0.502478 -19 TCCCGCTCTTGGCGGCTGCC 2 1 0 GGCGGCTGCC 0.512156 -33 CGTTGCGATAGTCTCCGGCC 4 21 1 GTCTCCGGCC 0.830736 -10 ********** Masking position 6 Map Score: 8.71269 Number of sites scoring better than the average of aligned sites = 3663 Number in coding regions = 3503 Number in noncoding regions = 160 Number of orfs with sites within 600 bp upstream = 132 Fraction of orfs with sites within 600 bp upstream = 0.0212014 Motif number 2 TGTTGACCGCGGCCGACCTGGCCGACGGC 1 10 0 GGCCGACCTG 0.995457 -25 CGGCGAATCTCCATCCCGCTCTTGGCGG 2 16 0 CTCCATCCCG 0.991018 -18 TCAATATTCCGTAAATCCTGCTATCATAGC 3 28 1 GTAAATCCTG 0.974132 -23 CTATCGCAACGGCAGTGCCGC 4 2 0 GGCAGTGCCG 0.995042 -29 ********** Masking position 8 Map Score: 1.7549 Number of sites scoring better than the average of aligned sites = 4619 Number in coding regions = 4332 Number in noncoding regions = 287 Number of orfs with sites within 600 bp upstream = 258 Fraction of orfs with sites within 600 bp upstream = 0.0414391 Motif number 3 TGACCGCGGCCGACCTGGCCGACGGC 1 6 0 CGACCGGCCG 0.586087 -29 ATCTCCATCCCGCTCTTGGCGGCTGCC 2 7 0 CGCTCTGGCG 0.545285 -27 GTAAATCCTGCTATCATAGCGTC 3 38 1 CTATCTAGCG 0.965166 -13 GGCCGGAGACTATCGCAACGGCAGTGCCGC 4 11 0 CTATCCAACG 0.981622 -20 ***** ***** Masking position 5 Map Score: 1.25283 Number of sites scoring better than the average of aligned sites = 2752 Number in coding regions = 2598 Number in noncoding regions = 154 Number of orfs with sites within 600 bp upstream = 154 Fraction of orfs with sites within 600 bp upstream = 0.024735 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0