AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/alignace/lib/ORF_mtub.txt -z/skink1/amcguire/genomes/mtub.fna -imarR_mtub_opreg_300.orf -g0.656 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.656 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 Rv1404 168 hypothetical protein Rv1404 #2 Rv1931c 132 hypothetical protein Rv1931c Motif number 1 TCGGTACCAGCCTCACCCGACGTCTCGCAGGA 1 17 0 CCCCCCGACG 0.995277 -152 TAGCATCTGACCATCGTCGACATTGATTATTT 1 79 0 CCTGTCGACA 0.956667 -90 TTTCCCGGGGCCGTCCCCGGCGTCAACTTCGT 1 141 0 CCTCCCGGCG 0.999328 -28 TACCCCTTTCCCGGGGCCGTCCCCGG 1 153 0 CCTCCCGGGG 0.993634 -16 AGACCGTGCACCGGTCTTGGCAGACTGTGCCC 2 11 0 CCGCTTGGCA 0.95583 -122 GGCGGCGCAGCCCTGCCCGAAAGACCGTGCAC 2 32 0 CCTCCCGAAA 0.961695 -101 GGGCAGGGCTGCGCCGCCGGCGTGTCCTAATC 2 46 1 GCCGCCGGCG 0.996409 -87 GGCGTCCACGCCACACACCGCACAGATTAGGA 2 70 0 CCCCACCGCA 0.942784 -63 TTGGCCAGGCGCTGGCCTGGCGTCCACGCCAC 2 88 0 GCGCCTGGCG 0.991817 -45 CCAGGCCAGCGCCTGGCCAACACTGGCATTCA 2 100 1 GCTGCCAACA 0.850851 -33 GCCAACACTGGCATTCATGGCGCGAAGA 2 115 1 GCTCATGGCG 0.976935 -18 ** * ******* Masking position 2 Map Score: 19.8597 Number of sites scoring better than the average of aligned sites = 25170 Number in coding regions = 23640 Number in noncoding regions = 1530 Number of orfs with sites within 600 bp upstream = 904 Fraction of orfs with sites within 600 bp upstream = 0.145198 Motif number 2 CTCCTGCGAGACGTCGGGTGAGGCTGGTAC 1 16 1 ACGTCGGGTG 0.946712 -153 ACTTCGTCGTACACCGTGCGGGTAAGTCAG 1 118 0 ACACCGTGCG 0.986076 -51 GACGAAGTTGACGCCGGGGACGGCCCCGGG 1 140 1 ACGCCGGGGA 0.960258 -29 GCCGGGGACGGCCCCGGGAAAGGGGTA 1 152 1 GCCCCGGGAA 0.913581 -17 CCTGCCCGAAAGACCGTGCACCGGTCTTGG 2 23 0 AGACCGTGCA 0.895081 -110 AGATTAGGACACGCCGGCGGCGCAGCCCTG 2 49 0 ACGCCGGCGG 0.840584 -84 TGTGGCGTGGACGCCAGGCCAGCGCCTGGC 2 87 1 ACGCCAGGCC 0.991298 -46 CGCCAGGCCAGCGCCTGGCCAACACTGGCA 2 98 1 GCGCCTGGCC 0.963696 -35 TCTTCGCGCCATGAATGCCAGTGTT 2 118 0 GCGCCATGAA 0.942428 -15 ********** Masking position 5 Map Score: 12.0023 Number of sites scoring better than the average of aligned sites = 12727 Number in coding regions = 11717 Number in noncoding regions = 1010 Number of orfs with sites within 600 bp upstream = 694 Fraction of orfs with sites within 600 bp upstream = 0.111468 Motif number 3 TGTGTCAGCAGACAACAGTATACGTTCTAA 1 51 1 GACAACAGTA 0.684317 -118 TCTGACCATCGTCGACATTGATTATTTAGA 1 76 0 GTCGACATTG 0.971616 -93 CAACTTCGTCGTACACCGTGCGGGTAAGTC 1 120 0 GTACACCGTG 0.876602 -49 CGTCCCCGGCGTCAACTTCGTCGTACACCG 1 132 0 GTCAACTTCG 0.918946 -37 CTTTCCCGGGGCCGTCCCCGGCGTCAACTT 1 144 0 GCCGTCCCCG 0.960036 -25 ACCGGTCTTGGCAGACTGTGCCC 2 4 0 GCAGACTGTG 0.970927 -129 ATTAGGACACGCCGGCGGCGCAGCCCTGCC 2 47 0 GCCGGCGGCG 0.973664 -86 CCAGCGCCTGGCCAACACTGGCATTCATGG 2 105 1 GCCAACACTG 0.981464 -28 ********** Masking position 6 Map Score: 1.75445 Number of sites scoring better than the average of aligned sites = 28723 Number in coding regions = 27263 Number in noncoding regions = 1460 Number of orfs with sites within 600 bp upstream = 899 Fraction of orfs with sites within 600 bp upstream = 0.144394 Motif number 4 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0