AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -ifnr_tpal_opreg_300.orf -g0.528 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.528 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 TP0382 83 T. pallidum predicted coding region TP0382 #2 TP0383 27 conserved hypothetical protein #3 TP0390 45 cell division protein (ftsZ) Motif number 1 ACGTCCACCCCCCCCCCCCCG 1 1 1 ACGTCACCCC 0.978458 -83 CGTCCACCCCCCCCCCCCCGACGAGAAAAAG 1 12 1 CCCCCCCCGA 0.998847 -72 GAACATTGTCACCCATACCGTTGCCGGTTGT 1 42 1 ACCCTACCGT 0.978278 -42 GATTTCCTACCTTCCCCTATATTTTTC 2 9 0 ACCTCCCCTA 0.98564 -19 ACCGCGCACAGCATGCGGCACG 3 2 1 CCGCCACAGC 0.994648 -44 CCTCCCATTCCCCTACACCGCGTGCCGCATG 3 22 0 CCCTCACCGC 0.998724 -24 TCCCCTCCCATTCCCCTACACC 3 34 0 CCCCCCCATT 0.987635 -12 **** ****** Masking position 8 Map Score: 12.3514 Number of sites scoring better than the average of aligned sites = 1027 Number in coding regions = 861 Number in noncoding regions = 166 Number of orfs with sites within 600 bp upstream = 100 Fraction of orfs with sites within 600 bp upstream = 0.0160617 Motif number 2 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0