AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -iilvY_ecoli_bsub_100.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ilvY 149 positive regulator for ilvC #2 gltC 146 transcriptional regulator (LysR family) Motif number 1 TTCGCGTTTGCGAGATTGAATTCACTATAT 1 48 1 CGAGATTGAA 0.969497 -102 CTATATGACAGGAAATTTATTGCGGAAATT 1 72 1 GGAAATTTAT 0.979858 -78 AATTTATTGCGGAAATTGATATATTCACAA 1 85 1 GGAAATTGAT 0.996138 -65 CGGTATTATCGGAAATTGATCGGGGGAGAG 2 16 0 GGAAATTGAT 0.996138 -131 AATCTCAAAATGAGATAGATGGATGTGAGA 2 122 1 TGAGATAGAT 0.955456 -25 ********** Masking position 5 Map Score: 7.09334 Number of sites scoring better than the average of aligned sites = 138 Number in coding regions = 121 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 2 CAATAAGAAGCACAACATCACGAGGAATCA 1 13 0 CACAACATCA 0.994422 -137 TTGATATATTCACAACGTCACATTGCAATT 1 100 1 CACAACGTCA 0.997948 -50 TTGCAATTTTTGCAACGTCAACATCGAGGG 1 122 1 TGCAACGTCA 0.993333 -28 ********** Masking position 5 Map Score: 3.36164 Number of sites scoring better than the average of aligned sites = 48 Number in coding regions = 45 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 TGTCATATAGTGAATTCAATCTCGCAAACGCGA 1 49 0 TGAATATCTC 0.884192 -101 AATTTATTGCGGAAATTGATATATTCACAACGT 1 85 1 GGAAAATATA 0.890621 -65 GGTCATAAAATCTAACAACTCTATAATCATTGT 2 45 1 TCTAACTCTA 0.945468 -102 TTGTAGGTTTTCAAAACGATATAAACAATATAT 2 74 1 TCAAAATATA 0.984269 -73 ATTCTTTTGATCTAAATTATATATTGTTTATAT 2 92 0 TCTAAATATA 0.964234 -55 ATAATTTAGATCAAAAGAATCTCAAAATGAGAT 2 105 1 TCAAAATCTC 0.988658 -42 GTTTGTCTCACATCCATCTATCTCATTTTG 2 127 0 TCACAATCTA 0.975529 -20 ***** ***** Masking position 10 Map Score: 2.23766 Number of sites scoring better than the average of aligned sites = 221 Number in coding regions = 186 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 4 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0