AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -iada_ecoli_hinf_100.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 alkA 70 3-methyl-adenine DNA glycosylase II, inducible #2 ada 73 O6-methylguanine-DNA methyltransferase; transcription activator/repressor #3 yojL 111 orf, hypothetical protein #4 yjfI 126 orf, hypothetical protein #5 yjfK 50 orf, hypothetical protein #6 aidB 68 putative acyl coenzyme A dehydrogenase Motif number 1 GAATAACGTTTATGCTGAAAGCGGATGAAT 1 40 1 TATGCTGAAA 0.870967 -31 CGGTCACCATCACGCAAAAACCAACAATCT 2 17 0 CACGCAAAAA 0.949008 -57 CGCTGAAAACAATGAAAAAAGGGCCCGCAG 3 36 0 AATGAAAAAA 0.835567 -76 ACTGAGTTTGTACGCTGAAAACAATGAAAA 3 48 0 TACGCTGAAA 0.868709 -64 TTACCAGCTATAGACAAAAAAAAACCATCC 4 43 0 TAGACAAAAA 0.774357 -84 ATAATTACGTATTGCAAATATTCATTTTAT 4 74 1 ATTGCAAATA 0.727241 -53 AAGTTTAAATATTAATAAAATGAATATTTG 4 88 0 ATTAATAAAA 0.528668 -39 TTTAGCGAGGCTGGCAAAAAAA 5 3 0 CTGGCAAAAA 0.960699 -48 TTTTGCCAGCCTCGCTAAAAGGCTGGCAAC 5 14 1 CTCGCTAAAA 0.949007 -37 CAACTATTTTAAGGATAAAAT 5 40 1 AAGGATAAAA 0.867412 -11 ACAGAAAGAGATTGCTAAAACATTC 6 6 0 ATTGCTAAAA 0.958364 -63 CCATGGATTCATGACAGAAAGAGATTGCTA 6 19 0 ATGACAGAAA 0.785287 -50 ********** Masking position 8 Map Score: 8.57582 Number of sites scoring better than the average of aligned sites = 3442 Number in coding regions = 2916 Number in noncoding regions = 526 Number of orfs with sites within 600 bp upstream = 545 Fraction of orfs with sites within 600 bp upstream = 0.0875361 Motif number 2 TGAAAGCAAAGCGCAGCGTCTGAATAACGT 1 19 1 GCGCAGCGTC 0.980426 -52 GATGGTGACCGGGCAGCCTAAAGGCTATCC 2 36 1 GGGCAGCCTA 0.987666 -38 TTTTTTTGCCAGCCTCGCTAAAAGGC 5 7 1 TGCCAGCCTC 0.996219 -44 TTAAAATAGTTGCCAGCCTTTTAGCGAGGC 5 22 0 TGCCAGCCTT 0.980581 -29 CATGAATCCATGGCAGTGACCATACTAATG 6 36 1 TGGCAGTGAC 0.979476 -33 CAATGGCAGTCACCATTAGTATG 6 56 0 TGGCAGTCAC 0.989166 -13 ********** Masking position 5 Map Score: 7.49522 Number of sites scoring better than the average of aligned sites = 873 Number in coding regions = 829 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 47 Fraction of orfs with sites within 600 bp upstream = 0.00754899 Motif number 3 AAGCGCAGCGTCTGAATAACGTTTATGCTGAAAG 1 27 1 TTGAATATTT 0.958594 -44 GCTCCCTGGTTAAGGATAGCCTTTAGGCTGCCCG 2 45 0 TAGGATGTTT 0.987091 -29 ACCATCCAAATCTGGATGGCTTTTCATAATTCTG 4 16 0 TTGGATGTTT 0.99634 -111 GCCATCCAGATTTGGATGGTTTTTTTTTGTCTAT 4 30 1 TTGGATGTTT 0.99634 -97 TATTATTCCATATAGATTAAGTTTAAATATTAAT 4 102 0 TTAGATATTT 0.958594 -25 * ***** * *** Masking position 7 Map Score: 2.89881 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 34 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 4 CCGGAATATGAAAGCAAAGCG 1 2 1 CGGAATATGA 0.922299 -69 ATGCTGAAAGCGGATGAATAAGGAGATGCG 1 51 1 CGGATGAATA 0.957823 -20 AGCGCAAGATTGTTGGTTTTTG 2 3 1 CGCAAGATTG 0.974128 -71 TGCGAACGGTCGCAAGAGTACACCAAAAAA 3 77 0 CGCAAGAGTA 0.992324 -35 TGCGACCGTTCGCATGAGGATAATCACGT 3 93 1 CGCATGAGGA 0.989837 -19 ********** Masking position 4 Map Score: 2.15178 Number of sites scoring better than the average of aligned sites = 284 Number in coding regions = 248 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 44 Fraction of orfs with sites within 600 bp upstream = 0.00706714 Motif number 5 GGTTTTTGCGTGATGGTGACCGGGCAGCCT 2 25 1 TGATGGTGAC 0.984094 -49 ATCCTCATGCGAACGGTCGCAAGAGTACAC 3 84 0 GAACGGTCGC 0.97511 -28 GTCACCATTAGTATGGTCACTGCCATGGAT 6 41 0 GTATGGTCAC 0.984744 -28 GTGACCATACTAATGGTGACTGCCATTG 6 51 1 TAATGGTGAC 0.986597 -18 ********** Masking position 7 Map Score: 0.598559 Number of sites scoring better than the average of aligned sites = 203 Number in coding regions = 188 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 6 ********** No masking Map Score: 8.33767e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 8.33767e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 8.33767e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0