AlignACE version 2.2 July 7, 1998 alignACE -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -icarP_ecoli_hinf_300.orf -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 carA 300 carbamoyl-phosphate synthetase, glutamine (small) subunit Motif number 1 AATAAAAACGAGCAGAAAAAAGTGGACCAA 1 27 0 AGCAGAAAAA 0.911632 -274 GCAAGAAGATTGCATGAAATAAAAACGAGC 1 44 0 TGCATGAAAT 0.930059 -257 ACGCTTGCGCAGCAAGAAGATTGCATGAAA 1 55 0 AGCAAGAAGA 0.956855 -246 ACAGGCATTAAGCGACAAAAAGATCATCTA 1 99 0 AGCGACAAAA 0.951597 -202 TGTCGCTTAATGCCTGTAAAACATGCATGA 1 112 1 TGCCTGTAAA 0.941377 -189 AACATGCATGAGCCACAAAATAATATAAAA 1 131 1 AGCCACAAAA 0.981379 -170 TGCCGCCGTTTGCCAGAAATTCGTCGGTAA 1 204 1 TGCCAGAAAT 0.973624 -97 TGAATTAATATGCAAATAAAGTGAGTGAAT 1 264 1 TGCAAATAAA 0.911729 -37 ********** Masking position 8 Map Score: 6.57931 Number of sites scoring better than the average of aligned sites = 1625 Number in coding regions = 1414 Number in noncoding regions = 211 Number of orfs with sites within 600 bp upstream = 239 Fraction of orfs with sites within 600 bp upstream = 0.0383874 Motif number 2 AGATCATCTAACCTGTTCTGGAAAACGCTTGCGCAGC 1 72 0 ATCTGGAACG 0.981862 -229 AGAACAGGTTAGATGATCTTTTTGTCGCTTAATGCCT 1 90 1 ATCTTTTGCG 0.956699 -211 TGGGCGCTAAAAGTCAACTTAATGGCGGGATTTTTTA 1 156 0 ATCTTAAGCG 0.995601 -145 TTTAGCGCCCATATCTCCAGAATGCCGCCGTTTGCCA 1 182 1 ATCAGAAGCG 0.991582 -119 AAATCAATGCAAATCTGCTTACCGACGAATTTCTGGC 1 215 0 ATCTTACGCG 0.988063 -86 TTTGCATATTAATTCACAATGATGACGTAAATCAATG 1 243 0 ATAATGAGCG 0.952572 -58 AAGTGAGTGAATATTCTCTGGAGGGTGTT 1 282 1 ATCTGGAGTG 0.982382 -19 * * ***** * ** Masking position 1 Map Score: 3.9737 Number of sites scoring better than the average of aligned sites = 607 Number in coding regions = 577 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 3 TTGCTGCGCAAGCGTTTTCCAGAACAGGTTAGA 1 70 1 ACGTTCCAGA 0.987106 -231 AAAAAATCCCGCCATTAAGTTGACTTTTAGCGC 1 157 1 GCATTGTTGA 0.951824 -144 GGCAAACGGCGGCATTCTGGAGATATGGGCGCT 1 185 0 GCATTGGAGA 0.989727 -116 CCAGAATGCCGCCGTTTGCCAGAAATTCGTCGG 1 198 1 GCGTTCCAGA 0.997497 -103 CCAGAAATTCGTCGGTAAGCAGATTTGCATTGA 1 216 1 GCGGTGCAGA 0.996193 -85 * **** ***** Masking position 6 Map Score: 1.63049 Number of sites scoring better than the average of aligned sites = 500 Number in coding regions = 470 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0